Please wait a minute...
Acta Phys. -Chim. Sin.  2017, Vol. 33 Issue (10): 2052-2057    DOI: 10.3866/PKU.WHXB201750105
ARTICLE     
Study on the Synthesis of DNA via Rolling Circle Amplification
Shu-Zhen LIU,Zhi-Qing ZHANG*(),Fang WANG,Ting ZHOU,Xiu-Feng WANG,Gou-Dong ZHANG,Ting-Ting LIU,Hong-Zhi ZHANG
Download: HTML     PDF(1312KB) Export: BibTeX | EndNote (RIS)      

Abstract  

Rolling circle amplification (RCA) is a simple and efficient isothermal enzymatic reaction, which has developed as a novel technology in the field of nucleic acid amplification. Its product has a wide range of applications in the assembly and preparation of multi-functional materials. Here, we report the effects of reaction time and the concentrations of deoxyribonucleoside triphosphates (dNTPs), polymerase, and primer on the product of RCA. The RCA product was characterized by methods including agarose gel electrophoresis, ultraviolet spectroscopy, and transmission electron microscopy (TEM). The results showed that the length of the RCA product was significantly affected by the reaction time, especially when the reaction time was less than 30 min. With an increase of dNTPs concentrations, the concentration and chain length of the RCA product increased. However, while the concentrations of enzyme and primer had little effect on the length of the RCA product, they had a large effect on its concentration. It is worth noting that the content of the RCA product decreased significantly in the presence of excess enzyme concentration.



Key wordsRolling circle amplification      Nucleic acid      dNTPs      Polymerase      Primer     
Received: 29 March 2017      Published: 10 May 2017
MSC2000:  O648  
Fund:  the Scientific Research Foundation for Returned Overseas Chinese Scholars(2014010615);National Natural Science Foundation of China(21603276);National Natural Science Foundation of China(21303267);Natural Science Foundation of Shandong Province, China(ZR2016BL14);Fundamental Research Funds for the Central Universities, China
Corresponding Authors: Zhi-Qing ZHANG     E-mail: zhangzq@upc.edu.cn
Cite this article:

Shu-Zhen LIU,Zhi-Qing ZHANG,Fang WANG,Ting ZHOU,Xiu-Feng WANG,Gou-Dong ZHANG,Ting-Ting LIU,Hong-Zhi ZHANG. Study on the Synthesis of DNA via Rolling Circle Amplification. Acta Phys. -Chim. Sin., 2017, 33(10): 2052-2057.

URL:

http://www.whxb.pku.edu.cn/10.3866/PKU.WHXB201750105     OR     http://www.whxb.pku.edu.cn/Y2017/V33/I10/2052

Oligonucleotide Sequence (5??3?)
circular template DNA1 TGTCTTCGCCTTCTTGTTTCC
TTTCCTTGAAACTTCTTCCTT
TCTTTCTTTCGACTAAGCACC
primer DNA2 GGCGAAGACAGGTGCTTAGTC
Table 1 Sequences of oligonucleotides used in RCA reactions.
Fig 1 Effect of reaction time on RCA product. (a, b) the agarose gel (0.6%) electrophoresis of RCA product at different time. bp indicates the number of bases.
Fig 2 TEM images of the RCA product. (a, b) TEM images of the RCA product at 30 min.
Fig 3 Effect of dNTPs molar concentration on RCA product. (a) The agarose gel (0.6%) electrophoresis of RCA product at different concentrations of dNTPs; (b) The UV-Vis spectra of RCA product at different concentrations of dNTPs; (c) The concentration of RCA product at different concentrations of dNTPs; (d) Comparison of analytical data for OD260/280 and OD260/230 at different concentrations of dNTPs. OD ratio represents the absorbance ratio.
Fig 4 Effect of phi29 DNA polymerase on RCA product. (a) The agarose gel (0.6%) electrophoresis of RCA product at different concentrations of phi29 DNA polymerase; (b) The UV-Vis spectra of RCA product at different concentrations of phi29 DNA polymerase; (c) Comparison of analytical data for OD260/280 and 260/230 at different concentrations of phi29 DNA polymerase. U indicates enzyme activity concentration.
Fig 5 Effect of the primer concentration on RCA product. (a) An agarose gel (0.6%) electrophoresis of RCA product at different concentrations of primer; (b) The UV-Vis spectra of RCA product at different concentrations of primer; (c) Comparison of analytical data for 260/280 and 260/230 at different concentrations of primer.
1 Ali M. M. ; Li F. ; Zhang Z. Q. ; Zhang K. X. ; Kang D. ; Ankrum J.A. ; Le X. C. ; Zhao W. A. Chem. Soc. Rev. 2014, 43, 3324.
2 Terpe K. Appl. Microbiol. Biotechnol. 2013, 97 (24), 10243.
3 Konry T. ; Smolina I. ; Yarmush J. M. ; Irimia D. ; Yarmush M. L. Small 2011, 7 (3), 395.
4 Deng Z. X. ; Tian Y. ; Lee S. H. ; Ribbe A. E. ; Mao C. D. Angew. Chem. Int. Ed. 2005, 44, 3582.
5 Wilner O. I. ; Shimron S. ; Weizmann Y. ; Wang Z. G. ; Willner I. Nano Lett. 2009, 9 (5), 2040.
6 Hamblin G. D. ; Carneiro K. M. M. ; Fakhoury J. F. ; Bujold K. E. ; Sleiman H. F. J. Am. Chem. Soc. 2012, 134 (6), 2888.
7 Ouyang X. Y. ; Li J. ; Liu H. J. ; Zhao B. ; Yan J. ; Ma Y. Z. ; Xiao S. J. ; Song S. P. ; Huang Q. ; Jie Chao J. ; Fan C. H. Small 2013, 9 (18), 3082.
8 Yan J. ; Hu C. Y. ; Wang P. ; Liu R. ; Zuo X. L. ; Liu X. W. ; Song S. P. ; Fan C. H. ; He D. N. ; Sun G. ACS Appl. Mater. Interfaces 2014, 6 (22), 20372.
9 Linck L. ; Rei? E. ; Bier F. ; Resch-Genger U. Anal. Methods 2012, 4, 1215.
10 Xue Q. W. ; Wang Z. G. ; Wang L. ; Jiang W. Bioconjug. Chem. 2012, 23 (4), 734.
11 Akter F. ; Mie M. ; Grimm S. ; Nygren P?. ; Kobatake E. Anal. Chem. 2012, 84 (11), 5040.
12 Zhu Y. ; Wang H. J. ; Wang L. ; Zhu J. ; Jiang W. ACS Appl. Mater. Interfaces 2016, 8 (4), 2573.
13 Zhao W. A. ; Cui C. H. ; Bose S. ; Guo D. ; Shen C. ; Wong W. P. ; Halvorsen K. ; Farokhzad O. C. ; Teo G. S. L. ; Philips J. ; Dorfman D. M. ; Karnik R. ; Karp J. M. Proc. Natl. Acad. Sci. (USA) 2012, 109, 19626.
14 Chen G. ; Liu D. ; He C. B. ; Gannett T. R. ; Lin W. B. ; Weizmann Y. J. Am. Chem. Soc. 2015, 137 (11), 3844.
15 Zhang Z. Q. ; Ali M. M. ; Eckert M. A. ; Kang D. K. ; Chen Y. Y. ; Sender L. S. ; Fruman D. A. ; Zhao W. A. Biomaterials 2013, 34, 9728.
16 Zhao W. A. ; Gao Y. ; Kandadai S. A. ; Brook M. A. ; Li Y. F. Angew. Chem. Int. Ed. 2006, 45, 2409.
17 Wu Z. S. ; Zhou H. ; Zhang S. B. ; Shen G. L. ; Yu R. Q. Anal. Chem. 2010, 82 (6), 2282.
18 Kim J. H. ; Jang M. ; Kim Y. J. ; Ahn H. J. J. Med. Chem. 2015, 58 (19), 7863.
19 Ye T. ; Chen J. Y. ; Liu Y. F. ; Ji X. H. ; Zhou G. H. ; He Z. K. ACS Appl. Mater. Interfaces 2014, 6 (18), 16091.
20 Chen A. Y. ; Ma S. Y. ; Zhou Y. ; Chai Y. Q. ; Yuan R. Anal. Chem. 2016, 88 (6), 3203.
21 Ruff L. E. ; Marciniak J. Y. ; Sanchez A. B. ; Esener S. C. ; Messmer B. T. Nanotechnol. Rev. 2014, 3, 569.
22 Liu D. Y. ; Daubendiek S. L. ; Zillman M. A. ; Ryan K. ; Kool E. T. J. Am. Chem. Soc. 1996, 118 (7), 1587.
23 Zhu G. Z. ; Hu R. ; Zhao Z. L. ; Chen Z. ; Zhang X. B. ; Tan W. H. J. Am. Chem. Soc. 2013, 135 (44), 16438.
24 Lieberman K. R. ; Cherf G. M. ; Doody M. J. ; Olasagasti F. ; Kolodji Y. ; Akeson M. J. Am. Chem. Soc. 2010, 132 (50), 17961.
25 Lu J. ; Chen Y. H. ; Liu D. M. ; Ren W. ; Lu Y. Q. ; Shi Y. ; Piper J. ; Paulsen I. ; Jin D. Y. Anal. Chem. 2015, 87, 10406.
26 Chen X. Q. ; Ye Y. ; Cheng H. ; Jiang Y. W. ; Wu Y. J. Agric. Food Chem. 2009, 57, 5795.
27 Bajaj A. ; Kondaiah P. ; Bhattacharya S. Biomacromolecules 2008, 9, 991.
28 Mohsen M. G. ; Kool E. T. Acc. Chem. Res. 2016, 49 (11), 2540.
29 Lin C. X. ; Wang X. ; Liu Y. ; Seeman N. C. ; Yan H. J. Am. Chem. Soc. 2007, 129, 14475.
[1] Yi-Fan RUAN,Nan ZHANG,Yuan-Cheng ZHU,Wei-Wei ZHAO,Jing-Juan XU,Hong-Yuan CHEN. New Developments in Photoelectrochemical Bioanalysis[J]. Acta Phys. -Chim. Sin., 2017, 33(3): 476-485.
[2] CONG Yong, XUE Ying. Quantitative Structure-Activity Relationship Study of the Non-Nucleoside Inhibitors of HCV NS5B Polymerase by Machine Learning Methods[J]. Acta Phys. -Chim. Sin., 2013, 29(08): 1639-1647.
[3] WANG Ya-Ping, ZHAO Xu-Hui, LU Xiang-Yu, ZUO Yu. Corrosion Protection of Ceria Particles in Mg-Rich Primer on AZ91D Magnesium Alloy[J]. Acta Phys. -Chim. Sin., 2012, 28(02): 407-413.
[4] KANG Xue-Li, CHEN Qi-Bin, SHANG Ya-Zhuo, LIU Hong-Lai. Interaction between Gemini and DNA at the Air/Water Interface[J]. Acta Phys. -Chim. Sin., 2011, 27(06): 1467-1473.
[5] Gao Hong-Wen;Zi Yan-Qin;Li Yu-Cheng. Langmuir Aggregation of Polychrome Blue on Nucleic Acids[J]. Acta Phys. -Chim. Sin., 2002, 18(06): 540-544.